View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9315_low_8 (Length: 206)
Name: NF9315_low_8
Description: NF9315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9315_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 47 - 170
Target Start/End: Complemental strand, 11794228 - 11794106
Alignment:
| Q |
47 |
ctataaatgaagactttgtgggaatttgataattgttgataataagttttaggggtgttcttcatttatcagaaggaaagcgcaaaaaagcataagacta |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11794228 |
ctataaatgaagactttgtgggaatttgataat-gttgataataagttttaggagtgttcttcttttatcagaaggaaagcgcaaaaaagcataagacta |
11794130 |
T |
 |
| Q |
147 |
agcaactcagtgcctaaaattcta |
170 |
Q |
| |
|
|||||||||| |||||||| |||| |
|
|
| T |
11794129 |
agcaactcagggcctaaaactcta |
11794106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University