View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9316_low_25 (Length: 210)
Name: NF9316_low_25
Description: NF9316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9316_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 53 - 165
Target Start/End: Complemental strand, 7422510 - 7422396
Alignment:
| Q |
53 |
acaaccaaatactagaatctatat--ctctttaagagcatgtcatcaaacatcacttgtcatcatttgtaacacaaactcgaaaatcattagttcagcgg |
150 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7422510 |
acaaccaaatactagaatctatatatctctttaagagcatgtcatcaaacatcacttgtcatcatttgtaacacaaactcgaaaatcattagttcagcgg |
7422411 |
T |
|
| Q |
151 |
tgagacttctgaagc |
165 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7422410 |
tgagacttctgaagc |
7422396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University