View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9317_high_2 (Length: 431)
Name: NF9317_high_2
Description: NF9317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9317_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 299
Target Start/End: Original strand, 41635106 - 41635390
Alignment:
| Q |
16 |
caatggcggtaggacccaaaatattattgatatttgcacctccatttctagcctttgtggaagaaaattcagagtgatgatgatgatgtgaatggatctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41635106 |
caatggcggtaggacccaaaatattattgatatttgcacctccatttctagcctttgtggaagaaaattcagagtgatgatgatgatgtgaatggatctc |
41635205 |
T |
 |
| Q |
116 |
atcttcatccataccatcagaagatgacacacactcaatgctatccaactccatcaactctcaccaaaccgctaaaacaaaaacaacccactaatcaaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41635206 |
atcttcatccataccatcagaagatgacacacactcaatgctatccaactccatcaactctcaccaaaccgctaaaacaaaaacaacccactaatcaaaa |
41635305 |
T |
 |
| Q |
216 |
tcgcaaatttcaccaaattaattatctgggta-tcccctttttctcaaaattttcttcccccaattgtctcccttattttcccag |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41635306 |
tcgcaaatttcaccaaattaattatctgggtattcccctttttctcaaaattttcttcccccaattgtctcccttattttcccag |
41635390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 368 - 421
Target Start/End: Original strand, 41635459 - 41635512
Alignment:
| Q |
368 |
tctgttctggggaagaacagaacagaacaggttcttttcttcgttgtctctctg |
421 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41635459 |
tctgttccggggaagaacagaacagaacaggttcttttcttcgttgtctctctg |
41635512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 732913 - 732852
Alignment:
| Q |
108 |
tggatctcatcttcatccataccatcagaagatgacacacactcaatgctatccaactccat |
169 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
732913 |
tggatctcatcttcatccattccatcagaagatgaaacacactcaatactatccaaatccat |
732852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University