View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9317_low_13 (Length: 274)
Name: NF9317_low_13
Description: NF9317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9317_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 81 - 266
Target Start/End: Complemental strand, 44816321 - 44816139
Alignment:
| Q |
81 |
ttaagaagagaattagctttagctggcttattataatggataattttcaaaaccagtacggtgctgttcctataagcaacaatgatctaattcataggga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816321 |
ttaagaagagaattagctttagctggcttattataatggataattttcaaaaccagtacggtgctgttcctataagcaacaatgatctaattcataggga |
44816222 |
T |
|
| Q |
181 |
acttgatactaccggcgttaatgttgatggtggcggaagcacacaagccatggcagatacaaccaccgcagttgacactaccacca |
266 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816221 |
acttgatactaccggcgt---tgttgatggtggcggaagcacacaagccatggcagatacaaccaccgcagttgacactaccacca |
44816139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 37 - 65
Target Start/End: Complemental strand, 44816412 - 44816384
Alignment:
| Q |
37 |
atatatatgtgatgtgattgcactcacaa |
65 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44816412 |
atatatatgtgatgtgattgcactcacaa |
44816384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University