View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9318_high_3 (Length: 311)
Name: NF9318_high_3
Description: NF9318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9318_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 22 - 299
Target Start/End: Complemental strand, 52769938 - 52769664
Alignment:
| Q |
22 |
aatgtctggagctgagtcagctgacagtgatgcggataacgataagaagaagcacgttgtcttgtattgtaatattgtattggctatctattgggactta |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52769938 |
aatgtctggagctgagtcagctgacagtgatgcggataacgataagaag---catgttgtcttgtattgtaatattgtattggctatctattgggactta |
52769842 |
T |
 |
| Q |
122 |
actcaactaatcatccaatccattaatctttgttacgatgagatgacgataacaacatcaattcgaattccaggaagctctgggtatttggatacacacc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52769841 |
actcaactaatcatccaatccattaatctttgttacgatgagatgacggtaacaacatcaattcgaattccaggaagctctgggtatttggatatacacc |
52769742 |
T |
 |
| Q |
222 |
ctgaaaggaaagtctctgtgtttaagaacccttacattttgtgtctcacttctgtagctagcattggtggattactct |
299 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52769741 |
ctgaaagaaaagtctctgtgtttaagaacccttacattttgtgtctcacttctgtagctagcattggtggattactct |
52769664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University