View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9318_low_19 (Length: 223)
Name: NF9318_low_19
Description: NF9318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9318_low_19 |
 | |
|
| [»] scaffold0031 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 255132 - 254940
Alignment:
| Q |
18 |
tcaacaaggtttttggaaatggtttagtggtgttatggacaacgctctttatcctgttttgtttcttgattacttgaaacattcttttcctatttttaat |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
255132 |
tcaacaaggtttttggaaatggttcagtggtgttatggacaatgctctttatcctgttttgtttcttgattacttgaaacattcttttcctatttttaat |
255033 |
T |
|
| Q |
118 |
cgtatgttagcccgaattcctgctctcttagggatcactttttcgcttacttatttgaattacagaggtcttcacattgttggtttctctgct |
210 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
255032 |
cttatgttagcccgaattcctgctctcttagggatcactttttctcttacttatttgaattacagaggtcttcacattgttggtttctctgct |
254940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 21244340 - 21244275
Alignment:
| Q |
40 |
tttagtggtgttatggacaacgctctttatcctgttttgtttcttgattacttgaaacattctttt |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21244340 |
tttagtggtgttatggacaatgctctttatcctgttttgtttcttgattacttgaaacattctttt |
21244275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 137 - 210
Target Start/End: Complemental strand, 21244270 - 21244197
Alignment:
| Q |
137 |
ctgctctcttagggatcactttttcgcttacttatttgaattacagaggtcttcacattgttggtttctctgct |
210 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| |||||||| | | ||||||| |||||||||||||||||| |
|
|
| T |
21244270 |
ctgctcttttagggatcacattttcgcttacttacttgaattatatacgtcttcatattgttggtttctctgct |
21244197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 89
Target Start/End: Complemental strand, 42660 - 42604
Alignment:
| Q |
33 |
gaaatggtttagtggtgttatggacaacgctctttatcctgttttgtttcttgatta |
89 |
Q |
| |
|
||||||| |||||||||| || ||||| ||| | ||||| ||||||||||||||||| |
|
|
| T |
42660 |
gaaatggattagtggtgtcatagacaatgctttgtatccagttttgtttcttgatta |
42604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University