View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9319_high_15 (Length: 254)

Name: NF9319_high_15
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9319_high_15
NF9319_high_15
[»] chr2 (1 HSPs)
chr2 (6-233)||(6008320-6008547)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 233
Target Start/End: Complemental strand, 6008547 - 6008320
Alignment:
6 tatggtgtttatgcatgattggagaaggaccaatgagaataatgtcaagtgtactttgtaagttggcttgtgtgtgcagtgacatctatatttgccgaca 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6008547 tatggtgtttatgcatgattggagaaggaccaatgagaataatgtcaagtgtactttgtaagttggcttgtgtgtgcagtgacatctatatttgccgaca 6008448  T
106 attgaaggaaccatcttgaggaagtcacgcatggcaatcacaagccatgttgcttttgcttagtgttaaaaatggacacgtggaagaaatccattggagg 205  Q
    ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6008447 attgaaggaaccatctttaggaagtcacacatggcaatcacaagccatgttgcttttgcttagtgttaaaaatggacacgtggaagaaatccattggagg 6008348  T
206 gtattctatgatttcgtttgtgtggtgg 233  Q
    ||||||||||||||||||||||||||||    
6008347 gtattctatgatttcgtttgtgtggtgg 6008320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University