View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_high_21 (Length: 234)
Name: NF9319_high_21
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 19133273 - 19133481
Alignment:
| Q |
15 |
agcatagattcaacctctgcaactttggatccttcatattttactttcacttttttgcttgctggctgatccgaaagagtaagaatttatatctacnnnn |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19133273 |
agcacagattcaacctctgcaactttggatccttcatattttactttcacttttttgcttgctggctgatccgaaagagtaagaatttatatctactttt |
19133372 |
T |
 |
| Q |
115 |
nnnacacacaaaagtttaggcgagttgggttcggcatctcaccggtgaaaactcaaaactcaaataactc-ttaacg-agatatccacatattatccacc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
19133373 |
tttacacacaaaagtttaggcgagttgggttcggcatctcaccggtgaaaactcaaaactcaaataactctttaacgtagatatccacatattatccacc |
19133472 |
T |
 |
| Q |
213 |
aatgatgtc |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
19133473 |
aatgatgtc |
19133481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 20732672 - 20732880
Alignment:
| Q |
15 |
agcatagattcaacctctgcaactttggatccttcatattttactttcacttttttgcttgctggctgatccgaaagagtaagaatttatatctacnnnn |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20732672 |
agcacagattcaacctctgcaactttggatccttcatattttactttcacttttttgcttgctggctgatccgaaagagtaagaatttatatctactttt |
20732771 |
T |
 |
| Q |
115 |
nnnacacacaaaagtttaggcgagttgggttcggcatctcaccggtgaaaactcaaaactcaaataactc-ttaacg-agatatccacatattatccacc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
20732772 |
tttacacacaaaagtttaggcgagttgggttcggcatctcaccggtgaaaactcaaaactcaaataactctttaacgtagatatccacatattatccacc |
20732871 |
T |
 |
| Q |
213 |
aatgatgtc |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
20732872 |
aatgatgtc |
20732880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University