View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_high_7 (Length: 321)
Name: NF9319_high_7
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 48 - 307
Target Start/End: Complemental strand, 41489386 - 41489126
Alignment:
| Q |
48 |
tggatagagtaaataaagggaagatattatcattataatctgcctccctattggtcaatactagtataactaactgtactatcaactgttaattgctcat |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41489386 |
tggatagagtaaataaagggaagatattatcattataatttgcctccctattggtcaatactagtataactaactgtactatcaactgttaattgctcat |
41489287 |
T |
 |
| Q |
148 |
attaactcctgttattaacattctcattggcattgtttgtattgcccgaattaagaaattatataagttgattgttaggggcaagtacaagctacctgac |
247 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41489286 |
attaactcctgtcattaacattctcattggcattgtttgtattgcccgaattaagaaattatataagttgattgttaggggcaagtacaagctacctgac |
41489187 |
T |
 |
| Q |
248 |
tcattatttttattttggatccacgagttagggattag-gggacttaggtaagttgaaagt |
307 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||| | ||||| ||||| |
|
|
| T |
41489186 |
tcattatttttattttggatacacgagttagggattagagggacttaagcaagttaaaagt |
41489126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 48 - 118
Target Start/End: Original strand, 9972896 - 9972966
Alignment:
| Q |
48 |
tggatagagtaaataaagggaagatattatcattataatctgcctccctattggtcaatactagtataact |
118 |
Q |
| |
|
||||||| | |||||||||||||| |||||||| ||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
9972896 |
tggatagtggaaataaagggaagaaattatcatcataattatcctctctattggtcaatactaatataact |
9972966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 305
Target Start/End: Original strand, 18663372 - 18663419
Alignment:
| Q |
259 |
attttggatccacgagttagggattag-gggacttaggtaagttgaaa |
305 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
18663372 |
attttggatccacgagttagggattagagggacataggcaagttgaaa |
18663419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University