View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_high_8 (Length: 318)
Name: NF9319_high_8
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 23 - 308
Target Start/End: Complemental strand, 43033928 - 43033641
Alignment:
| Q |
23 |
cgtccatgtaagaatcatagggcatctctgtgggtagactt-ggagaataatcttggagtaatcttaggaaacactttgaggtgtgaagtgaggaattca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43033928 |
cgtccatgtaagaatcatagggcatctctgtgggtagactttggagaataatcttggagtaatcttaggaaacactttgaggtgtgaagtgaggaattca |
43033829 |
T |
 |
| Q |
122 |
tgtaaactctctacatgacaaaagaatattagagagactgagaaatcaaaggaagagtgaaaataga-ggtcgaaagagatttagagatttttgttgggc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
43033828 |
tgtaaactctctacatgacaaaagaatattagagagactgagaaatcaaaggaagagtgaaaatagagggtcgaaagggatttagagatttttgttgggc |
43033729 |
T |
 |
| Q |
221 |
tgtttctcaacaatggaaagcaagggaccatgtaaactttattgtactggtttgtttatgctcatagtggattcattgttgctctctg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43033728 |
tgtttctcaacaatggaaagcaagggaccatgtaaactttattgtactggtttgtttatgctcatagtggattcattgttgctctctg |
43033641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University