View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_14 (Length: 378)
Name: NF9319_low_14
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_14 |
 |  |
|
| [»] chr6 (11 HSPs) |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 309; Significance: 1e-174; HSPs: 11)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 18 - 378
Target Start/End: Complemental strand, 13628332 - 13627972
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttgttaatactgcattgcatttttg |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||||||||||||| |||||||||| |||||||| |||||||||||| ||||||||||||| |
|
|
| T |
13628332 |
cgtacaatacactaaatagcaagaccccttcctagactctgcgtatgcgggagttttagtgcactggattgccctttgttaatactacattgcatttttg |
13628233 |
T |
 |
| Q |
118 |
tacctcacaataaccaccactttaatttcctttactgttatcatacgtttctacttctcctgatattgttctaagttcctttaaaaccctagtagcctac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13628232 |
tacctcacaataaccaccactttaatttcctttactgttatcatacgtttctacttctcctgatattgttctaagttcctttaaaaccctagtagcctac |
13628133 |
T |
 |
| Q |
218 |
accaacaaatagaattaagccattatcaccatctttcaaatagtttcaaaatcttattctaaacttgtgtagcttcgaagtttgaatccttccactattg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13628132 |
accaacaaatagaattaagccattatcaccatctttcaaatagtttcaaaatcttattctaaacttgtgtagcttcgaagtttgaattcttccactattg |
13628033 |
T |
 |
| Q |
318 |
caagcaatttgtgcggctttgtagtgtgctgctgttaggggggaagtgcctaaggtaaggc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13628032 |
caagcaatttgtgcggctttgtagtgtgctgctgttaggagggaagtgcctaaggtaaggc |
13627972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 383836 - 383764
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||| | ||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
383836 |
cgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcc |
383764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 90
Target Start/End: Complemental strand, 3116192 - 3116133
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||| ||| ||||||||||| || ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3116192 |
aaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcc |
3116133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 1347021 - 1347093
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
1347021 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
1347093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 1354833 - 1354761
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
1354833 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
1354761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 31 - 90
Target Start/End: Original strand, 12885985 - 12886044
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||| ||| ||||||||| |||| | |||||||| ||||||||||||||||||| ||||| |
|
|
| T |
12885985 |
aaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcc |
12886044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 29355933 - 29355859
Alignment:
| Q |
18 |
cgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| || || ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
29355933 |
cgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
29355859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 23930203 - 23930138
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccg |
83 |
Q |
| |
|
|||||||||||| | || ||| ||||||||| | || | ||| ||||||||||||||||||||||| |
|
|
| T |
23930203 |
cgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccg |
23930138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Complemental strand, 30786411 - 30786378
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
30786411 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
30786378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 40 - 84
Target Start/End: Original strand, 11395842 - 11395886
Alignment:
| Q |
40 |
gaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||| |||||| |
|
|
| T |
11395842 |
gaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 22 - 90
Target Start/End: Original strand, 13267788 - 13267856
Alignment:
| Q |
22 |
caatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||| |||| ||| ||||||||| || | ||||||||||||||||| |||||||||| ||||| |
|
|
| T |
13267788 |
caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcc |
13267856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 25)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 27474362 - 27474434
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||||| ||| ||| ||||||||| | || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
27474362 |
cgtacaatacactgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcc |
27474434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 45402178 - 45402250
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||| | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
45402178 |
cgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcc |
45402250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 1517387 - 1517315
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| || | ||| |||||||||||||| | ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
1517387 |
cgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgcc |
1517315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 4349720 - 4349792
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
4349720 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
4349792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 23768396 - 23768325
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgc |
89 |
Q |
| |
|
|||||||||||| |||| ||| ||| ||||| |||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
23768396 |
cgtacaatacaccaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 23796547 - 23796613
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| |||| | ||| ||||| |||||||||||||||||| |
|
|
| T |
23796547 |
cgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagtgcaccgg |
23796613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 34725174 - 34725102
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
34725174 |
cgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
34725102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 35253263 - 35253191
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
35253263 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcc |
35253191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 46248029 - 46247957
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||| ||||| ||||| |
|
|
| T |
46248029 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgcc |
46247957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 38478358 - 38478275
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttgttaata |
101 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| || | ||| |||||||||||| ||||||||||| ||||| ||| |||||| |
|
|
| T |
38478358 |
cgtacaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgcccttttttaata |
38478275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 10378811 - 10378745
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| || | ||| |||||||||||||||||||||||| |
|
|
| T |
10378811 |
cgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgg |
10378745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 47214591 - 47214660
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggatt |
87 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||| | ||| |||||||||||| ||||||||| |||| |
|
|
| T |
47214591 |
cgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgcaccagatt |
47214660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 31 - 90
Target Start/End: Complemental strand, 42304270 - 42304211
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||| ||| ||||||||| | || | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
42304270 |
aaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcc |
42304211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 31 - 82
Target Start/End: Complemental strand, 45264462 - 45264411
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||| ||| |||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
45264462 |
aaatggtgggaccccttctcagaccctgcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 19 - 90
Target Start/End: Original strand, 46991887 - 46991958
Alignment:
| Q |
19 |
gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||| ||| ||| ||||||||| | || | |||||||| ||||||||||||||||||| ||||| |
|
|
| T |
46991887 |
gtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgcc |
46991958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 84
Target Start/End: Original strand, 9939570 - 9939612
Alignment:
| Q |
42 |
ccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
||||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
9939570 |
ccccttctcggaccctgcgtatgcgggagctttagtgcaccgg |
9939612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 14617120 - 14617186
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| |||| ||| || |||||| | || | ||| |||||||||||||||||||||||| |
|
|
| T |
14617120 |
cgtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgg |
14617186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 90
Target Start/End: Complemental strand, 45812611 - 45812541
Alignment:
| Q |
20 |
tacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||| |||| ||| ||||||||| || | | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
45812611 |
tacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcc |
45812541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Original strand, 10668348 - 10668381
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
10668348 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
10668381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 18742020 - 18741967
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||| ||| ||||||||| |||| | |||||||||| ||||||||||||||||| |
|
|
| T |
18742020 |
aaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgg |
18741967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 27201744 - 27201793
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca |
80 |
Q |
| |
|
|||| ||| ||||||||| | || |||||||||||||||||||||||||| |
|
|
| T |
27201744 |
aaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgca |
27201793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 81
Target Start/End: Complemental strand, 33594185 - 33594144
Alignment:
| Q |
40 |
gaccccttctcagatcttgcgtatgcgggagctttagtgcac |
81 |
Q |
| |
|
||||||||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
33594185 |
gaccccttcccagaccctgcgtatgcgggagctttagtgcac |
33594144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 19414519 - 19414591
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | | | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
19414519 |
cgtacaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgcc |
19414591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 32632633 - 32632569
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| || | | ||| ||||||||||||| |||||||| |
|
|
| T |
32632633 |
cgtacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcacc |
32632569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 43768223 - 43768287
Alignment:
| Q |
20 |
tacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||| || | ||| ||||||||| |||| | ||||||| ||||||||||| |||||||| |
|
|
| T |
43768223 |
tacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgg |
43768287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 24)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 242 - 348
Target Start/End: Complemental strand, 9416284 - 9416179
Alignment:
| Q |
242 |
atcaccatctttcaaatagtttcaaaatcttattctaaacttgtgtagcttcgaagtttgaatccttccactattgcaagcaatttgtgcggctttgtag |
341 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||| ||||||| ||||||| || |||||||| |||| | ||||||||| ||| ||||||||||||| |
|
|
| T |
9416284 |
atcaccatctttcaaataatttccaagtcttattccaaacttg-gtagctttaaattttgaatctttcccatgttgcaagcattttctgcggctttgtag |
9416186 |
T |
 |
| Q |
342 |
tgtgctg |
348 |
Q |
| |
|
| ||||| |
|
|
| T |
9416185 |
tatgctg |
9416179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 7879697 - 7879769
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||| |||||||||| ||||| |
|
|
| T |
7879697 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgcc |
7879769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 31591185 - 31591113
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||| | || ||||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
31591185 |
cgtacaatacaataaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgcc |
31591113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 57 - 90
Target Start/End: Complemental strand, 38262233 - 38262200
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38262233 |
tgcgtatgcgggagctttagtgcaccggattgcc |
38262200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 40463935 - 40464000
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccg |
83 |
Q |
| |
|
|||| ||||||| |||| ||| ||||||||||| || | ||||||||||||||||| ||||||||| |
|
|
| T |
40463935 |
cgtataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccg |
40464000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 21172085 - 21172013
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
21172085 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
21172013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 27889392 - 27889320
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||| || |||||| ||||| |
|
|
| T |
27889392 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcc |
27889320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 33871986 - 33871922
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||| | || ||||||| ||||||||||||||| |
|
|
| T |
33871986 |
cgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcacc |
33871922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 35787345 - 35787273
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| | | ||||||||| | || ||||||||||||||||||| | |||||||| ||||| |
|
|
| T |
35787345 |
cgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgggttgcc |
35787273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 42391176 - 42391104
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
42391176 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
42391104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 47077931 - 47077859
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| || | | | | |||||||||||| ||||||||||||||||| |
|
|
| T |
47077931 |
cgtacaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgcc |
47077859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 48735198 - 48735126
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
48735198 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
48735126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 19 - 90
Target Start/End: Complemental strand, 23619052 - 23618981
Alignment:
| Q |
19 |
gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||| |||| ||| ||||||||| |||| ||||||| ||| |||||||||||||| ||| ||||| |
|
|
| T |
23619052 |
gtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcc |
23618981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 19 - 90
Target Start/End: Original strand, 32758319 - 32758390
Alignment:
| Q |
19 |
gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
32758319 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
32758390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 38604585 - 38604652
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt-agtgcaccgg |
84 |
Q |
| |
|
|||||||||||| |||| |||||||||||| | || | |||||||||||||||||| |||||||||| |
|
|
| T |
38604585 |
cgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagtgcaccgg |
38604652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 2541095 - 2541029
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
||||| |||||| |||| ||| ||||||||| | | | |||||||||||||||||||||||||||| |
|
|
| T |
2541095 |
cgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgg |
2541029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 8149021 - 8148960
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca |
80 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||| |||||||||||| ||| ||||||||| |
|
|
| T |
8149021 |
cgtacaatacaccaaatggtgggaccccttcccaga-cttgcgtatgcgagagttttagtgca |
8148960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 23419750 - 23419688
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca |
80 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| ||| ||||||| |||||| ||||||||||| |
|
|
| T |
23419750 |
cgtacaatacaccaaatggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgca |
23419688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 28362221 - 28362156
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||| ||||| |||| ||||||||| ||||||||| |
|
|
| T |
28362221 |
cgtacaatacaccaaatggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcaccgg |
28362156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 35334891 - 35334826
Alignment:
| Q |
19 |
gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
||||||||||| ||| ||| ||||||||| | || | ||||||||| |||||||||||||||||| |
|
|
| T |
35334891 |
gtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgg |
35334826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Original strand, 36602545 - 36602578
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
36602545 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
36602578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 10693149 - 10693077
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||| || ||||| |
|
|
| T |
10693149 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcc |
10693077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 11617664 - 11617592
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| || | ||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
11617664 |
cgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgcc |
11617592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 18512529 - 18512457
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||| | || | |||||||||||||||||| |||||| || ||||| |
|
|
| T |
18512529 |
cgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgcc |
18512457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 29)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 6411898 - 6411833
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccg |
83 |
Q |
| |
|
|||||||||||| |||| || ||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
6411898 |
cgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 22609846 - 22609918
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || ||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
22609846 |
cgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcc |
22609918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 25517246 - 25517174
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | |||| ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
25517246 |
cgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgcc |
25517174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 39203595 - 39203667
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
39203595 |
cgtacaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcc |
39203667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 40272888 - 40272816
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
40272888 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
40272816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 54484772 - 54484844
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
54484772 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
54484844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 12914111 - 12914039
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| |||| | ||| ||||||||||||| | |||||||| ||||| |
|
|
| T |
12914111 |
cgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgcc |
12914039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 45948912 - 45948848
Alignment:
| Q |
20 |
tacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||| || | ||| ||||||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
45948912 |
tacaatacaccaattggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 24577917 - 24577998
Alignment:
| Q |
19 |
gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttgttaat |
100 |
Q |
| |
|
|||||||||||||||| ||| || || ||| |||| | ||| ||| |||||||| ||||||||||||||||| ||| ||||| |
|
|
| T |
24577917 |
gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcccttttttaat |
24577998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 31904933 - 31904868
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagacccc-ttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||||||||||| |||| ||| |||||| ||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
31904933 |
cgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagctttagtgcacc |
31904868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 5173771 - 5173723
Alignment:
| Q |
42 |
ccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||| | || |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5173771 |
ccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgcc |
5173723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 26869787 - 26869859
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| |||||||| | || | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
26869787 |
cgtacaatacaccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgcc |
26869859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 52926295 - 52926223
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||| ||||| | || | |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
52926295 |
cgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcc |
52926223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 13628868 - 13628794
Alignment:
| Q |
18 |
cgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| || || ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
13628868 |
cgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
13628794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 31 - 90
Target Start/End: Complemental strand, 24851364 - 24851305
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||| ||| ||||||||| | |||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
24851364 |
aaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcc |
24851305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 19 - 82
Target Start/End: Original strand, 33235614 - 33235676
Alignment:
| Q |
19 |
gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||||||||||||||| ||| ||||||| | |||| ||| ||||||||| |||||||||||||| |
|
|
| T |
33235614 |
gtacaatacactaaatggtgggacccct-cgcagaccttacgtatgcggaagctttagtgcacc |
33235676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 90
Target Start/End: Original strand, 516515 - 516565
Alignment:
| Q |
40 |
gaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
516515 |
gaccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgcc |
516565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 57 - 99
Target Start/End: Complemental strand, 4495713 - 4495671
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgccatttgttaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
4495713 |
tgcgtatgcgggagctttagtgcaccgggttgcccttttttaa |
4495671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 44 - 82
Target Start/End: Complemental strand, 31922889 - 31922851
Alignment:
| Q |
44 |
ccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
31922889 |
ccttcccagatcttacgtatgcgggagctttagtgcacc |
31922851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 34771440 - 34771374
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| |
|
|
| T |
34771440 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
34771374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Complemental strand, 10484653 - 10484620
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
10484653 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
10484620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 31592928 - 31593005
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttg |
95 |
Q |
| |
|
|||||||||||| |||| ||| ||| ||||| | || | ||| |||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
31592928 |
cgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttg |
31593005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Original strand, 40390361 - 40390394
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
40390361 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
40390394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Original strand, 47624219 - 47624252
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
47624219 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
47624252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Complemental strand, 54032608 - 54032575
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
54032608 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
54032575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 1217169 - 1217241
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| | | ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
1217169 |
cgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
1217241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 7943071 - 7943143
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||| |||| ||| || ||||| |||| | ||||||||||||||||||||||||| || ||||| |
|
|
| T |
7943071 |
cgtacaatacatcaaatggtgggatccctttccagaccatgcgtatgcgggagctttagtgcactgggttgcc |
7943143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 15797301 - 15797373
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||| ||||||| ||||||||||| ||||| |
|
|
| T |
15797301 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcc |
15797373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 22122993 - 22122921
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||| ||||| ||||||||||| ||||| |
|
|
| T |
22122993 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgcc |
22122921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 46890 - 46962
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
46890 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
46962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 21)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 45071323 - 45071395
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || ||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
45071323 |
cgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcc |
45071395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 35261738 - 35261819
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttgttaa |
99 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| || | |||||||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
35261738 |
cgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttttaa |
35261819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 29521761 - 29521690
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgc |
89 |
Q |
| |
|
|||||||||||| |||| ||| || ||| || |||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
29521761 |
cgtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgc |
29521690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 39461072 - 39460998
Alignment:
| Q |
18 |
cgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| || || ||||||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
39461072 |
cgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
39460998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 90
Target Start/End: Original strand, 12625951 - 12626021
Alignment:
| Q |
20 |
tacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||| |||| ||| |||||| || | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
12625951 |
tacaatacaccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
12626021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 44530208 - 44530274
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
44530208 |
cgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgg |
44530274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 2626581 - 2626658
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttg |
95 |
Q |
| |
|
|||||||||||| |||| || ||||||||| |||| | ||| ||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
2626581 |
cgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgccctttg |
2626658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 16013513 - 16013581
Alignment:
| Q |
18 |
cgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| |||| | ||| |||||||||||||||||||||||| |
|
|
| T |
16013513 |
cgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgg |
16013581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 18164797 - 18164760
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgccattt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18164797 |
tgcgtatgcgggagctttagtgcaccgggttgccattt |
18164760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 13160760 - 13160832
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
13160760 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcc |
13160832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 28817702 - 28817630
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||| | || | |||||||||||||||||||||||| ||| ||||| |
|
|
| T |
28817702 |
cgtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgcc |
28817630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 29877153 - 29877217
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||||||||||||||| |||||||||| |
|
|
| T |
29877153 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcacc |
29877217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 31457231 - 31457303
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||| |||| || ||||||||| || | | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
31457231 |
cgtacaatacatcaaatggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgcc |
31457303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 36720855 - 36720919
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||||||||||| |||||||||||||| |
|
|
| T |
36720855 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacc |
36720919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 55 - 90
Target Start/End: Original strand, 10857925 - 10857960
Alignment:
| Q |
55 |
cttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10857925 |
cttgcgtatgcgggagctttagtgcaccgggttgcc |
10857960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 8484014 - 8483948
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| || | ||| |||||| || |||| | |||||||||||||||||||| ||||||| |
|
|
| T |
8484014 |
cgtacaatacaccaattggtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccgg |
8483948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 12670326 - 12670260
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| |
|
|
| T |
12670326 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
12670260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 90
Target Start/End: Original strand, 26102578 - 26102648
Alignment:
| Q |
20 |
tacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
26102578 |
tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcc |
26102648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 82
Target Start/End: Complemental strand, 8897841 - 8897776
Alignment:
| Q |
17 |
acgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||| | || | ||| ||||||||||||||| |||||| |
|
|
| T |
8897841 |
acgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacc |
8897776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Complemental strand, 27468129 - 27468096
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
27468129 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
27468096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 30454173 - 30454101
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||| |||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
30454173 |
cgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
30454101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 27)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 9671238 - 9671310
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
9671238 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
9671310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 10546222 - 10546294
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
10546222 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
10546294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 11514495 - 11514566
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||| ||| |||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
11514495 |
cgtacaatacaccaaatggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtgcaccggattgcc |
11514566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 24860064 - 24859992
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| || |||||||||| || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
24860064 |
cgtacaatacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgcc |
24859992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 8455392 - 8455320
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8455392 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgcc |
8455320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 36871551 - 36871622
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
36871551 |
cgtacaatacaccaaatggtgggaccccttcccggacct-gcgtatgcgggagctttagtgcaccgggttgcc |
36871622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 25641560 - 25641630
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattg |
88 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | ||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
25641560 |
cgtacaatacaccaaattgtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattg |
25641630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 17 - 90
Target Start/End: Original strand, 23397822 - 23397895
Alignment:
| Q |
17 |
acgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| || | | | |||||||||||| ||||||||||| ||||| |
|
|
| T |
23397822 |
acgtacaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcc |
23397895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 99341 - 99281
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg |
78 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
99341 |
cgtacaatacaccaaatggtggaaccccttctcagaccctgtgtatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 95
Target Start/End: Original strand, 10543772 - 10543836
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttg |
95 |
Q |
| |
|
|||| ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
10543772 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttg |
10543836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 90
Target Start/End: Original strand, 14530376 - 14530451
Alignment:
| Q |
17 |
acgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||||| || || ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
14530376 |
acgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
14530451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 21779337 - 21779265
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
21779337 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
21779265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 19 - 82
Target Start/End: Original strand, 14444788 - 14444851
Alignment:
| Q |
19 |
gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||| |||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||| |
|
|
| T |
14444788 |
gtacgatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
14444851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 19977790 - 19977707
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttgttaata |
101 |
Q |
| |
|
|||||||||||| |||| ||| || |||||| | | |||| ||||||||||||||||||||||| |||| || ||| |||||| |
|
|
| T |
19977790 |
cgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcaccagattacccttttttaata |
19977707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 25079793 - 25079714
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttgtt |
97 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||| | || | ||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
25079793 |
cgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgccctttgtt |
25079714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 57 - 95
Target Start/End: Complemental strand, 124951 - 124913
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgccatttg |
95 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
124951 |
tgcgtatgcgggagctttagtgcaccgggttgccttttg |
124913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 17896319 - 17896381
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca |
80 |
Q |
| |
|
||||||||| || |||| ||| ||||||||||| || | |||||||| ||||||||||||||| |
|
|
| T |
17896319 |
cgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgca |
17896381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 26684696 - 26684626
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattg |
88 |
Q |
| |
|
||||||||| ||||||| ||| |||| |||| | | | ||||||||||||||||||| |||||||||||| |
|
|
| T |
26684696 |
cgtacaatatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattg |
26684626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 39499306 - 39499236
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattg |
88 |
Q |
| |
|
||||||||||| |||| ||| || ||||| || ||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
39499306 |
cgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcaccagattg |
39499236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 95
Target Start/End: Complemental strand, 40762311 - 40762233
Alignment:
| Q |
17 |
acgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttg |
95 |
Q |
| |
|
||||||||||||| |||| ||| ||||| ||| || | |||||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
40762311 |
acgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgccctttg |
40762233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 44643582 - 44643648
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||| || |||| ||| ||||||||| |||| | ||||||||||||||| |||||||||||| |
|
|
| T |
44643582 |
cgtacaatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgg |
44643648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Original strand, 22371210 - 22371243
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
22371210 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
22371243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 25632568 - 25632645
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttg |
95 |
Q |
| |
|
|||||||||||| |||| ||| || ||||| | | ||| |||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
25632568 |
cgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccctttg |
25632645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 31158502 - 31158445
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattg |
88 |
Q |
| |
|
|||| ||| ||||||||| |||| | ||||||||||||||||||||| |||| ||||| |
|
|
| T |
31158502 |
aaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacctgattg |
31158445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 17668061 - 17668133
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| | | ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
17668061 |
cgtacaatacaccaaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgcc |
17668133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 25249814 - 25249742
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| || |||||| | | | |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
25249814 |
cgtacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgcc |
25249742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 32781364 - 32781308
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt |
74 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||| | || ||||||||||||||| |
|
|
| T |
32781364 |
cgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgggagcttt |
32781308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 13)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 90
Target Start/End: Original strand, 16957374 - 16957445
Alignment:
| Q |
19 |
gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
16957374 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
16957445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 7097836 - 7097772
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| | | | |||||||||||||||||||||||||| |
|
|
| T |
7097836 |
cgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc |
7097772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 24448949 - 24449021
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
24448949 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgcc |
24449021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 40 - 95
Target Start/End: Original strand, 25622541 - 25622596
Alignment:
| Q |
40 |
gaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttg |
95 |
Q |
| |
|
||||||||| | || | |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25622541 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttg |
25622596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 16880723 - 16880657
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| |||| ||| |||| |||| | || | |||||||||||||||||||||||||||| |
|
|
| T |
16880723 |
cgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgg |
16880657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 94
Target Start/End: Original strand, 39801597 - 39801651
Alignment:
| Q |
40 |
gaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccattt |
94 |
Q |
| |
|
||||||||| |||| | | |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39801597 |
gaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccattt |
39801651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 32703481 - 32703553
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
32703481 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
32703553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 38879640 - 38879714
Alignment:
| Q |
18 |
cgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| || || ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
38879640 |
cgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
38879714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 44 - 90
Target Start/End: Complemental strand, 29184111 - 29184065
Alignment:
| Q |
44 |
ccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||| ||||| | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
29184111 |
ccttgtcagaccatgcgtatgcgggagctttagtgcaccgggttgcc |
29184065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 43574665 - 43574731
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
||||||||| || |||| ||| ||||||||| | || | |||||||||||||||||||| ||||||| |
|
|
| T |
43574665 |
cgtacaatataccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagcaccgg |
43574731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 8170060 - 8169988
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||| || |||||||||| ||||| |
|
|
| T |
8170060 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcc |
8169988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 34154890 - 34154818
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| ||||||| |||| ||||||||||| ||||| |
|
|
| T |
34154890 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcc |
34154818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 22 - 90
Target Start/End: Original strand, 35710374 - 35710442
Alignment:
| Q |
22 |
caatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
35710374 |
caatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgcc |
35710442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 13100 - 13028
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||| |||| | |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
13100 |
cgtacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgcc |
13028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 24209 - 24137
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
24209 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcc |
24137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000009; HSPs: 30)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 30639438 - 30639510
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| | || | ||| ||||||||||||||||||||| || ||||| |
|
|
| T |
30639438 |
cgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgcc |
30639510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 40915887 - 40915959
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| || |||||| | || | ||||||||||||||||| |||||||||||||||| |
|
|
| T |
40915887 |
cgtacaatacaccaaatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgcc |
40915959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 17 - 81
Target Start/End: Complemental strand, 41018871 - 41018807
Alignment:
| Q |
17 |
acgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac |
81 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| |||| |||||||||| || |||||||||||| |
|
|
| T |
41018871 |
acgtacaatacaccaaatagtgggaccccttcccagaccttgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 78
Target Start/End: Original strand, 14983895 - 14983953
Alignment:
| Q |
20 |
tacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg |
78 |
Q |
| |
|
||||||||||||||| ||| ||||||||| | || | |||||||||||||||||||||| |
|
|
| T |
14983895 |
tacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
14983953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 20225041 - 20225118
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttg |
95 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
20225041 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttg |
20225118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 20639735 - 20639662
Alignment:
| Q |
18 |
cgtacaatacactaaa-tagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| ||| | ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
20639735 |
cgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
20639662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 5648317 - 5648389
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||| ||||||| || ||||| |
|
|
| T |
5648317 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcc |
5648389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 6430702 - 6430630
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| |||| |||| | || | |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
6430702 |
cgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcc |
6430630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 10277833 - 10277761
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| |||| |||||||| |||| | ||| |||||||||| | ||||| ||||||||||| |
|
|
| T |
10277833 |
cgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccggattgcc |
10277761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 12711525 - 12711461
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||||||||||| |||| | | |||||||||||||| || |||||||||| | |||||||||||| |
|
|
| T |
12711525 |
cgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacc |
12711461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 29207974 - 29207902
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
29207974 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
29207902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 83
Target Start/End: Complemental strand, 30352643 - 30352591
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccg |
83 |
Q |
| |
|
|||| ||| ||||||||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
30352643 |
aaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccg |
30352591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 51865114 - 51865042
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| | ||||||| | || | ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
51865114 |
cgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggactgcc |
51865042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 19 - 90
Target Start/End: Original strand, 25629109 - 25629180
Alignment:
| Q |
19 |
gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||||| |||| ||| ||||||||| | || | | | |||||||||||||||||||||||| ||||| |
|
|
| T |
25629109 |
gtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgcc |
25629180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 31 - 90
Target Start/End: Complemental strand, 44363193 - 44363134
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||| ||| ||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
44363193 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
44363134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 55 - 90
Target Start/End: Original strand, 48033422 - 48033457
Alignment:
| Q |
55 |
cttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48033422 |
cttgcgtatgcgggagctttagtgcacctgattgcc |
48033457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 56 - 90
Target Start/End: Original strand, 19425922 - 19425956
Alignment:
| Q |
56 |
ttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
19425922 |
ttgcgtatgcgggagctttagtacaccggattgcc |
19425956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 30690250 - 30690188
Alignment:
| Q |
20 |
tacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
|||||||||| || | ||| ||||||||| | || | |||||||||||||||||||||||||| |
|
|
| T |
30690250 |
tacaatacaccaattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
30690188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 84
Target Start/End: Complemental strand, 34257034 - 34256992
Alignment:
| Q |
42 |
ccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
34257034 |
ccccttctcagaccttgcacatgcgggagctttagtgcaccgg |
34256992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 90
Target Start/End: Complemental strand, 38755962 - 38755912
Alignment:
| Q |
40 |
gaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
38755962 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
38755912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 90
Target Start/End: Complemental strand, 40553991 - 40553941
Alignment:
| Q |
40 |
gaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
||||||||| | || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
40553991 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
40553941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 55766542 - 55766476
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
||||||||||||| ||| ||| ||||| || | || |||||||||||| ||||||||||||||||| |
|
|
| T |
55766542 |
cgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgg |
55766476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Original strand, 11394950 - 11394983
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
11394950 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
11394983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Original strand, 11404677 - 11404710
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
11404677 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
11404710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 84
Target Start/End: Original strand, 28494223 - 28494276
Alignment:
| Q |
31 |
aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||| ||| ||||||||| |||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
28494223 |
aaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgg |
28494276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 90
Target Start/End: Original strand, 35532090 - 35532123
Alignment:
| Q |
57 |
tgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
35532090 |
tgcgtatgcgggagctttagtgcaccgggttgcc |
35532123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 57 - 96
Target Start/End: Original strand, 2813225 - 2813265
Alignment:
| Q |
57 |
tgcgtatgcgggagcttt-agtgcaccggattgccatttgt |
96 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
2813225 |
tgcgtatgcgggagctttaagtgcaccggattgccctttgt |
2813265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 9987908 - 9987844
Alignment:
| Q |
20 |
tacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg |
84 |
Q |
| |
|
|||||||||| |||| ||| ||||||||| || ||||| ||||||||||||||| |||||||| |
|
|
| T |
9987908 |
tacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggagctttaatgcaccgg |
9987844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 48598901 - 48598829
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| ||||| |||||| ||||||||||| ||||| |
|
|
| T |
48598901 |
cgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgcc |
48598829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 55830797 - 55830733
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc |
82 |
Q |
| |
|
||||||||||||| ||| ||| ||||| || | || |||||||||||| ||||||||||||||| |
|
|
| T |
55830797 |
cgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcacc |
55830733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 30636 - 30708
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
30636 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
30708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 48710 - 48638
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
48710 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
48638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 10873 - 10932
Alignment:
| Q |
22 |
caatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac |
81 |
Q |
| |
|
|||||||| |||| ||| ||||||||| | || | ||||||||||||||||||||||||| |
|
|
| T |
10873 |
caatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
10932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 10126 - 10054
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| | || | ||| ||||| |||||| |||||||||| ||||| |
|
|
| T |
10126 |
cgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgcc |
10054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 20454 - 20382
Alignment:
| Q |
18 |
cgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc |
90 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| | || | ||| ||||| |||||| |||||||||| ||||| |
|
|
| T |
20454 |
cgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgcc |
20382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University