View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_18 (Length: 357)
Name: NF9319_low_18
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 19 - 350
Target Start/End: Complemental strand, 30941393 - 30941062
Alignment:
| Q |
19 |
aagggttggtactgaatctcctgataacttttacttcactgtgacttctagaagtcttttagttctatgcgatataaggaaccctttgaagccagtattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30941393 |
aagggttggtactgaatctcctgataacttttacttcactgtgacttctagaagtcttttagttctatgcgatataaggaaccctttgaagccagtattg |
30941294 |
T |
|
| Q |
119 |
caatggaggcacggcattgatgaaccgtgctacatgactgtattaagtttgtctacgttgagatcccactcaaaagaagatacttttcagttggcttctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30941293 |
caatggaggcacggcattgatgaaccgtgctacatgactgtattaagtttgtctacgttgagatcccactcaaaagaagatacttttcagttggcttctg |
30941194 |
T |
|
| Q |
219 |
aaatgggattttgcattatcttgggatcattttggaattctgagttcaatatcttctgctatggacctgcatcatttcgaaaaggttctattacttcaac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30941193 |
aaatgggattttgcattatcttgggatcattttggaattctgagttcaatatcttctgctatggacctgcatcatttcgaaaaggttctattacttcaac |
30941094 |
T |
|
| Q |
319 |
gctttcaaagattaacacaacattctctgctt |
350 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
30941093 |
gctttcaaagattaacacaacattctgtgctt |
30941062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University