View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_39 (Length: 291)
Name: NF9319_low_39
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 43797141 - 43797385
Alignment:
| Q |
1 |
tttacatttgttcagttgttgatgttttatttagatgcttaaaatttatgttctgtgcatgtaattagcttcttttaccttattctaaattttacccgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797141 |
tttacatttgttcagttgttgatgttttatttagatgcttaaaatttctgttctgtgcatgtaattagcttcttttaccttattctaaattttacccgtg |
43797240 |
T |
|
| Q |
101 |
atgatttcttaagaaatagagtaagtattattcatcgaggtttttaacaggattatcctttggtcttcttgagtatatgtttcattgattccttatgagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797241 |
atgatttcttaagaaatagagtaagtattattca----------taacaggattatcctttggtcttcttgagtatatgtttcattgattccttatgagt |
43797330 |
T |
|
| Q |
201 |
ttagtctttgtaactttcgtttttcttgtcccactttttatctttggtattcttt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43797331 |
ttagtctttgtaactttcgtttttcttgtccaactttttatctttggtattcttt |
43797385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 113 - 211
Target Start/End: Original strand, 43798345 - 43798447
Alignment:
| Q |
113 |
gaaatagagtaagtattattcatcgaggtttttaa----caggattatcctttggtcttcttgagtatatgtttcattga-ttccttatgagtttagtct |
207 |
Q |
| |
|
||||||||| || |||| |||||||||| |||||| ||||||||| ||| |||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
43798345 |
gaaatagagcaactatttttcatcgaggcttttaattaacaggattatgctt-ggtcttcttgagtacatgtttcattgatttccttatgagtttagtct |
43798443 |
T |
|
| Q |
208 |
ttgt |
211 |
Q |
| |
|
|||| |
|
|
| T |
43798444 |
ttgt |
43798447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University