View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9319_low_48 (Length: 259)

Name: NF9319_low_48
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9319_low_48
NF9319_low_48
[»] chr7 (1 HSPs)
chr7 (19-130)||(19378571-19378682)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 130
Target Start/End: Complemental strand, 19378682 - 19378571
Alignment:
19 tcaatcttttgtgtgcgaactagtttttatataagcttaatgtatataaacaaatcttttatctcatttgtcttatggttacgttttctttgttacacta 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
19378682 tcaatcttttgtgtgcgaactagtttttatataagcttaatgtatataaacaaatcttttatctcatttgtcttatggtttcgttttctttgttacacta 19378583  T
119 atatctcagtat 130  Q
    ||||||||||||    
19378582 atatctcagtat 19378571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University