View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_50 (Length: 259)
Name: NF9319_low_50
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 130
Target Start/End: Complemental strand, 19378682 - 19378571
Alignment:
| Q |
19 |
tcaatcttttgtgtgcgaactagtttttatataagcttaatgtatataaacaaatcttttatctcatttgtcttatggttacgttttctttgttacacta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19378682 |
tcaatcttttgtgtgcgaactagtttttatataagcttaatgtatataaacaaatcttttatctcatttgtcttatggtttcgttttctttgttacacta |
19378583 |
T |
|
| Q |
119 |
atatctcagtat |
130 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19378582 |
atatctcagtat |
19378571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University