View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_55 (Length: 256)
Name: NF9319_low_55
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 48751109 - 48751289
Alignment:
| Q |
19 |
agagacgcgtaggctagaaattcccataatttttcctttccaggcaattaaatctcgctgatcaattctatgagagggaatggcgaggatagcatcaatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48751109 |
agagacgcgtaggctagaaattcccataatttttcctttccaggcaattaaatctcgttgatcaattctatgagagggaatggcgaggatagcatcaatc |
48751208 |
T |
|
| Q |
119 |
acataccaaggcagcttttgtctcagctaaaccacatctcaattacctaaacgagtgatgtatgagtttttgttggttttga |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48751209 |
acataccaaggcagcttttttctcagctaaaccacatctcaattacctaaacgagtgatgtatga-tttttgttggttttga |
48751289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 201 - 237
Target Start/End: Original strand, 48751281 - 48751317
Alignment:
| Q |
201 |
tggttttgacttttaagttatggcttctgtgatacag |
237 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
48751281 |
tggttttgacttttaagttatggcttatgtgacacag |
48751317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University