View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_56 (Length: 254)
Name: NF9319_low_56
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 233
Target Start/End: Complemental strand, 6008547 - 6008320
Alignment:
| Q |
6 |
tatggtgtttatgcatgattggagaaggaccaatgagaataatgtcaagtgtactttgtaagttggcttgtgtgtgcagtgacatctatatttgccgaca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6008547 |
tatggtgtttatgcatgattggagaaggaccaatgagaataatgtcaagtgtactttgtaagttggcttgtgtgtgcagtgacatctatatttgccgaca |
6008448 |
T |
 |
| Q |
106 |
attgaaggaaccatcttgaggaagtcacgcatggcaatcacaagccatgttgcttttgcttagtgttaaaaatggacacgtggaagaaatccattggagg |
205 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6008447 |
attgaaggaaccatctttaggaagtcacacatggcaatcacaagccatgttgcttttgcttagtgttaaaaatggacacgtggaagaaatccattggagg |
6008348 |
T |
 |
| Q |
206 |
gtattctatgatttcgtttgtgtggtgg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6008347 |
gtattctatgatttcgtttgtgtggtgg |
6008320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University