View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_58 (Length: 253)
Name: NF9319_low_58
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 30584819 - 30585045
Alignment:
| Q |
17 |
catcacacacatacatatcttaagaaacaaacnnnnnnngtgaaaatctcatacaatgacacattagtcgttaatcaacactcttctcacatttctcatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30584819 |
catcacacacatacatatcttaagaaacaaacaaaaaaagtgaaaatctcatacaatgacacattagtcgttaatcaacactcttctcacacttctcatt |
30584918 |
T |
 |
| Q |
117 |
ttcttcacattgcttctagcgacggtaactaaccgtggctaaaacaaaatggcaacaattagcgacgaagaacgcgacggtaacggcattaatcaaacac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30584919 |
ttcttcacattgcttctagcgacggtaactaaccgtggctaaaacaaaatggcaacaattagcgacgaagaacgcgacggtaacggaattaatcaaacac |
30585018 |
T |
 |
| Q |
217 |
cgttacgaatccctgaattgccctatg |
243 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
30585019 |
cgttacgaatccctgaattgctctatg |
30585045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University