View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_66 (Length: 247)
Name: NF9319_low_66
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_66 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 43666299 - 43666081
Alignment:
| Q |
13 |
aaacgcaaacacaaacacacactcgttgtgtcatcactatggagcctctctcttccactaaacaaaatcatnnnnnnnnnnnnnnnnnnnctctaactaa |
112 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
43666299 |
aaactcaaacacaaacacacactcattgtgtcatcactatggagcctttctcttccactaaacaaaatcataacaacaacaaca------ctctaactaa |
43666206 |
T |
|
| Q |
113 |
accttctcttcatgttgaatctccaccacttgaaccaagtcctctccgtaagatcatagtcgttgcttccatagcagcaggtgttcagtttggctgggcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666205 |
accttctcttcatgttgaatctccaccacttgaacctagtcctctccgtaagatcatagtcgttgcttccatagcagcaggtgttcagtttggctgggcc |
43666106 |
T |
|
| Q |
213 |
ctacagctttcacttttaactccct |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43666105 |
ctacagctttcacttttaactccct |
43666081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University