View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_71 (Length: 242)
Name: NF9319_low_71
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 12 - 203
Target Start/End: Original strand, 9916074 - 9916265
Alignment:
| Q |
12 |
tttggtggttgaggaataggccaaaaaggttgcagagggcatatgatatgctttaatcacaaaaatggttaaagtaaaaaagcaagtggtaaagaggaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9916074 |
tttggtggttgaggaataggccaaaaaggttgcagagggcatatgatatgctttaatcacaaaaatggttaaagtaaaaaagcaagtggtaaagaggaat |
9916173 |
T |
|
| Q |
112 |
tggaggaactatcttaaatattgggattgagtgttgtagtatatatttattcannnnnnngtcaagtaggaattcactattttgtaatcatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| ||||| |
|
|
| T |
9916174 |
tggaggaactatcttaaatattgggattgagggttgtagtatatatttattcatttttttgtcaattaggaattcactattttgtattcatt |
9916265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University