View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_72 (Length: 241)
Name: NF9319_low_72
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_72 |
 | |
|
| [»] chr3 (4 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 22 - 241
Target Start/End: Complemental strand, 1630023 - 1629804
Alignment:
| Q |
22 |
catacaattactttaattttttattttaaataattactcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagacataaccttcc |
121 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1630023 |
catacaattactttcattttttattttaaataattactcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagacataaccttcc |
1629924 |
T |
|
| Q |
122 |
aaaataccgccggtccacacaagggtcaagctgtggcgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1629923 |
aaaataccgccggtccacacaagggtcaagctgtggcgctaagatcagcgtccgatctctcagttttctatcggtgtgccatatcaggttatcaagacac |
1629824 |
T |
|
| Q |
222 |
tctgatggctcatgcacaac |
241 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1629823 |
tctgatggctcatgcacaac |
1629804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 58 - 241
Target Start/End: Complemental strand, 1606689 - 1606506
Alignment:
| Q |
58 |
ctcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagacataaccttccaaaataccgccggtccacacaagggtcaagctgtgg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1606689 |
ctcttggatcatttaaatttaggtattgatggacttcacttcattgcacgtgacataaccttccaaaataccgccggtccacacaagggtcaagcagtgg |
1606590 |
T |
|
| Q |
158 |
cgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacactctgatggctcatgcacaac |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1606589 |
cgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacactctgatggctcatgcacaac |
1606506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 45 - 241
Target Start/End: Original strand, 10820698 - 10820894
Alignment:
| Q |
45 |
ttttaaataattactcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagacataaccttccaaaataccgccggtccacacaag |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10820698 |
ttttaaataattactcttggatcatttaaatttaggtattgatggacttcacttcattgcacgtgacataaccttccaaaataccgccggtccacacaag |
10820797 |
T |
|
| Q |
145 |
ggtcaagctgtggcgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacactctgatggctcatgcacaac |
241 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||||||| || ||||| |||||| | ||||| ||||| |||||||| || |||||||||||||||| |
|
|
| T |
10820798 |
ggtcaagcagtggcgctccgatcagcctctgatctctccgtcttctaccggtgtacaatatcgggttaccaagacaccctcatggctcatgcacaac |
10820894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 58 - 241
Target Start/End: Complemental strand, 1623811 - 1623628
Alignment:
| Q |
58 |
ctcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagacataaccttccaaaataccgccggtccacacaagggtcaagctgtgg |
157 |
Q |
| |
|
|||||| ||| |||||||| ||| |||||||||||||| ||||||||||| ||||| ||||| |||||||| || ||||| ||||| || |||||||||| |
|
|
| T |
1623811 |
ctcttgaatcttttaaattcaggcattgatggacttcatttcattgcacgtgacattacctttcaaaatactgctggtcctcacaaaggccaagctgtgg |
1623712 |
T |
|
| Q |
158 |
cgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacactctgatggctcatgcacaac |
241 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||||| ||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
1623711 |
cgctccgatcagcctccgatctctctgtcttctatcggtgtgctatatcgggctatcaagacactctgatggctcatgcacaac |
1623628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 58 - 241
Target Start/End: Complemental strand, 18781505 - 18781322
Alignment:
| Q |
58 |
ctcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagacataaccttccaaaataccgccggtccacacaagggtcaagctgtgg |
157 |
Q |
| |
|
|||||| ||| |||||||| ||| |||||||||||||| |||||||| || |||||||||||||||||||| || ||||| || || ||||||||||||| |
|
|
| T |
18781505 |
ctcttgaatcttttaaattcaggcattgatggacttcatttcattgcccgcgacataaccttccaaaatactgctggtcctcataaaggtcaagctgtgg |
18781406 |
T |
|
| Q |
158 |
cgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacactctgatggctcatgcacaac |
241 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||||| ||||| || || |||||||| || ||||| ||||| |||| |
|
|
| T |
18781405 |
cgctccgatcagcctccgatctctctgtcttctatcggtgtgctatatcgggctaccaagacacccttatggcccatgcgcaac |
18781322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University