View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_74 (Length: 240)
Name: NF9319_low_74
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_74 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 30520733 - 30520958
Alignment:
| Q |
1 |
ttctcatggcataatttgttcaagtgttaggaaagagcttattaattatt--gtgttataattagttgctgatggtaatatgcagttagtaaatcactat |
98 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30520733 |
ttctcatggtataatttgttcaagtgttaggaaagagcttattaattattatgtgttataattagttgctgatggtaatatgcagttagtaaatcactat |
30520832 |
T |
|
| Q |
99 |
gtaaagtgcattagatactcattgtaataaattttgatcaatctatcaatttttaataagtaatctttctctcaagttgttatagttagttgctgatgat |
198 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30520833 |
gtaaagtgcattagatactgattgtaataaattttgctcaatctatcaatttttaataagtaatctttctctcaagttgttatagttagttgctgatgat |
30520932 |
T |
|
| Q |
199 |
aatacgtagttagtatatcactatgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30520933 |
aatacgtagttagtatatcactatgt |
30520958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 102
Target Start/End: Original strand, 30520910 - 30520960
Alignment:
| Q |
52 |
tgttataattagttgctgatggtaatatgcagttagtaaatcactatgtaa |
102 |
Q |
| |
|
||||||| ||||||||||||| ||||| | |||||||| |||||||||||| |
|
|
| T |
30520910 |
tgttatagttagttgctgatgataatacgtagttagtatatcactatgtaa |
30520960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University