View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_86 (Length: 226)
Name: NF9319_low_86
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 27 - 211
Target Start/End: Original strand, 39740257 - 39740445
Alignment:
| Q |
27 |
cgcttaaatcatggggttcaatggatgtcttaccaaataaaaaatgattatggataaattgtttttattcttagaggattgcaacttcttagaaatttga |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39740257 |
cgcttaaatcatggggttcaatggatgtattaccaaataaaaaatgattatggataaattgtttttattcttagaggatcgcaacttcttagaaatttga |
39740356 |
T |
 |
| Q |
127 |
acattcctcaactagataaaactacttactaagtgacc----atatcagcaaacataagaaaaactatgaggggctagacccttaactg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39740357 |
acattcctcaactagataaaactacttactaagtgaccatatatatcagcaaacataagaaaaactatgaggggctagacccttaactg |
39740445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University