View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_88 (Length: 223)
Name: NF9319_low_88
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_88 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 101 - 207
Target Start/End: Original strand, 44565117 - 44565223
Alignment:
| Q |
101 |
ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44565117 |
ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt |
44565216 |
T |
 |
| Q |
201 |
gggtctc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
44565217 |
gggtctc |
44565223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 102 - 182
Target Start/End: Complemental strand, 36035975 - 36035895
Alignment:
| Q |
102 |
tgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactaca |
182 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||| ||| |||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
36035975 |
tgttatctgatgtgttagtggctataggaggaaattgctgcagtggtatcaactgtgctctttgtgtctggagtgactaca |
36035895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University