View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9319_low_88 (Length: 223)

Name: NF9319_low_88
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9319_low_88
NF9319_low_88
[»] chr2 (2 HSPs)
chr2 (101-207)||(44565117-44565223)
chr2 (102-182)||(36035895-36035975)


Alignment Details
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 101 - 207
Target Start/End: Original strand, 44565117 - 44565223
Alignment:
101 ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44565117 ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt 44565216  T
201 gggtctc 207  Q
    |||||||    
44565217 gggtctc 44565223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 102 - 182
Target Start/End: Complemental strand, 36035975 - 36035895
Alignment:
102 tgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactaca 182  Q
    |||||||||||||||| |||||||||||| |||| ||| ||| ||||||  ||||||||||| ||||||||||||||||||    
36035975 tgttatctgatgtgttagtggctataggaggaaattgctgcagtggtatcaactgtgctctttgtgtctggagtgactaca 36035895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University