View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_90 (Length: 221)
Name: NF9319_low_90
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_90 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 204
Target Start/End: Original strand, 2891478 - 2891660
Alignment:
| Q |
22 |
cagtagctatatatcccagcaaaaacagagggtgaaataatcaactgtttggttgatttaactgttgatgattatggatccaattgcacacattacataa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2891478 |
cagtagctatatatcccagcaaaaacagagggtgaaataatcaactgtttggttgatttaactgttgatgattatggatccaattgcacacattacataa |
2891577 |
T |
 |
| Q |
122 |
aatcattcgcttctaaaatatgtgcagggatttcaaaattcaacctattacaactttcatagctttctctctcatcttctgtg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2891578 |
aatcattcgcttctaaaatatgtgcagggatttcaaaattcaacctattacaactttcatagctttctctctcatcttctgtg |
2891660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University