View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_93 (Length: 207)
Name: NF9319_low_93
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_93 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 189
Target Start/End: Original strand, 11193784 - 11193960
Alignment:
| Q |
13 |
ataattctcactgaatcccctcttcttctctattctgctacacctcttttctctcatacaccctccccttattgtcacaactgcttcagaaccttaccac |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11193784 |
ataatcctcactgaatcccctcttcttctctattctgctacacctcttttctctcatacaccctccccttattgtcacaactgcttcagaaccttaccac |
11193883 |
T |
|
| Q |
113 |
cttcacaaacatttcaatgtccttcttgctcaaactaccttttctgcagccaaaaatgcctctccattgccctcaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11193884 |
cttcacaaacatttcaatgtccttcttgctcaaactaccttttctgcagccaaaaatgcctctccattgccctcaat |
11193960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University