View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9319_low_99 (Length: 203)
Name: NF9319_low_99
Description: NF9319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9319_low_99 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 10119013 - 10119219
Alignment:
| Q |
1 |
caaacctctagtttcttccacacaccacaaaactaaacatgaatatcacaccaattgatttgccatcatttactctaaaatgcttgatcaacca----tg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10119013 |
caaacctctagtttcttccacacaccacaaaactaaacatgaatatcacaccaattgatttgccatcatttactctaaaatgcttgatcaaccaaccatg |
10119112 |
T |
 |
| Q |
97 |
catagcaccatccnnnnnnnttagccatacagatttttcattgattgatcattatttttatccaatggtgttctctaagctttgcatattttaagcatga |
196 |
Q |
| |
|
|| |||||||||| ||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119113 |
cacagcaccatccaacaaaattagctatacagatttttcattgattgatcgttatttttctccaatggtgttctctaagctttgcatattttaagcatga |
10119212 |
T |
 |
| Q |
197 |
aaattgt |
203 |
Q |
| |
|
||||||| |
|
|
| T |
10119213 |
aaattgt |
10119219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University