View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9320_low_10 (Length: 295)
Name: NF9320_low_10
Description: NF9320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9320_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 89 - 278
Target Start/End: Original strand, 9062186 - 9062383
Alignment:
| Q |
89 |
tcatagcacacataaacttgcaaatatgatcacaatgtctccactgaccttat-----------gtgttggcttcgacaataagtaatatatgtctcaag |
177 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9062186 |
tcatagcacacataaacttgcaaatat---cacaatgtctccactgaccttatgtgtggattatgtgttggcttcgacaataagtaatatatgtctcaag |
9062282 |
T |
 |
| Q |
178 |
gtcatttgttttaatcattaatttcaaagacagcactaagcaatattaaagcaatagcaacattattctttttgataagcatgctaacactattttattt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9062283 |
gtcatttgttttaatcattaatttcaaagacagcactaagcaatattaaagcaatagcaacattattctttttgataagcatgctaacactattttattt |
9062382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 9062099 - 9062134
Alignment:
| Q |
1 |
cgagttattgacaagaatatgatgttaaagtccacc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9062099 |
cgagttattgacaagaatatgatgttaaagtccacc |
9062134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University