View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9320_low_19 (Length: 241)
Name: NF9320_low_19
Description: NF9320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9320_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 5 - 76
Target Start/End: Complemental strand, 33327448 - 33327377
Alignment:
| Q |
5 |
ggtgagtttggtgtgtacatttgttgtgtgcaaccaccgtataggtagaggtttgtggttgatgattctgat |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33327448 |
ggtgagtttggtgtgtacatttgttgtgtgcaaccaccgtataggtagaggtttgtggttgatgattctgat |
33327377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 111 - 226
Target Start/End: Complemental strand, 33327342 - 33327209
Alignment:
| Q |
111 |
tgattttgaagaatctcaccattttttgttgttgttattggttgagagtaggt------------------tatattatatgcatatagaatatgtgatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
33327342 |
tgattttgaagaatctcaccattttttgttgttgttattggttgagagtatgtaatatgtatgcaatatgttatattatatgcatatagaatatgtgatg |
33327243 |
T |
|
| Q |
193 |
tgataccctatgatttgcttagaatatgaaaact |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33327242 |
tgataccctatgatttgcttagaatatgaaaact |
33327209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University