View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9320_low_21 (Length: 240)
Name: NF9320_low_21
Description: NF9320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9320_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 2474565 - 2474778
Alignment:
| Q |
1 |
cggtattcttattaatataaattgtttttgtnnnnnnnnnnnntaaatacactcagcagtgttgttcagtgcaacagctgaacgcccttagttatacgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2474565 |
cggtattcttattaatataaattgtttttgtaaatagaaaaaataaatatactcagcagtgttgttcggtgcaacagctgaacgcccttagttatacgac |
2474664 |
T |
 |
| Q |
101 |
tgagaattttaatatttaacttccctacaaactctgctctgaatggcaaggaaggagaattttgctatgaaggtag-tttgatgtagattataaacgact |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2474665 |
tgagaattttaatatttaacttccctacaaactctgctctgaatggcaaggaaggagaattttgctatgaaggtagttttgatgtagattataaacgact |
2474764 |
T |
 |
| Q |
200 |
tttctgcatatggt |
213 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2474765 |
tttctgcatatggt |
2474778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University