View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9320_low_38 (Length: 219)
Name: NF9320_low_38
Description: NF9320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9320_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 49 - 205
Target Start/End: Original strand, 23992560 - 23992716
Alignment:
| Q |
49 |
atttccaaactcctatcacttattgccacaacctaagtatcatatccctattagataatgcagtgcttcatatttaagaccaaacatatggagctctaaa |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23992560 |
atttccaaactcctatcacttattgccacaacctaagtatcatatccctattacataatgcagtgcttcatatttaggaccaaacatatggagctctaaa |
23992659 |
T |
 |
| Q |
149 |
tctttgatgaagagaaagtagtcaattaggaatctcatagtacatcatgtctctgct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23992660 |
tctttgatgaagagaaagtagtcaattaggaatctcatagtacatcatgtccctgct |
23992716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 120
Target Start/End: Complemental strand, 55032826 - 55032754
Alignment:
| Q |
49 |
atttccaaactcctatcacttattgccacaacctaag-tatcatatccctattagataatgcagtgcttcata |
120 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||| ||| ||||||||||| ||||| |||||||||||| |
|
|
| T |
55032826 |
atttccaaactcctatcacttattgtgacaacttaagttattgtatccctattacataatacagtgcttcata |
55032754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 196
Target Start/End: Complemental strand, 55032754 - 55032722
Alignment:
| Q |
164 |
aagtagtcaattaggaatctcatagtacatcat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
55032754 |
aagtagtcaattaggaatctcatagtacatcat |
55032722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 49 - 199
Target Start/End: Original strand, 7768939 - 7769089
Alignment:
| Q |
49 |
atttccaaactcctatcacttattgccacaacctaagtatcatatccctattagataatgcagtgcttcatatttaagaccaaacatatggagctctaaa |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
7768939 |
atttccaaactcctatcacttattgccacaacctaagtatcatatccctattacataatgcagtgcttcatatttaggaccaaacatatgaagctctaaa |
7769038 |
T |
 |
| Q |
149 |
tctttgatgaagagaaagtagtcaattaggaatctcatagtacatcatgtc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7769039 |
tctttgatgaagagaaagtagtcaattagaaatctcatagtacatcatgtc |
7769089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 49 - 199
Target Start/End: Original strand, 39169603 - 39169762
Alignment:
| Q |
49 |
atttccaaactcctatcacttattgccacaacctaagtatcatatccctattagat---------aatgcagtgcttcatatttaagaccaaacatatgg |
139 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
39169603 |
atttccaaactcctatcacttattgcgacaacctaagtattatatccctattacatgatttacataatgcagtgcttcatatttaggaccaaacatatga |
39169702 |
T |
 |
| Q |
140 |
agctctaaatctttgatgaagagaaagtagtcaattaggaatctcatagtacatcatgtc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39169703 |
agctctaaatctttgatgaagagaaagtagtcaattaggaatctcatagtacatcatgtc |
39169762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University