View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9321_high_15 (Length: 273)

Name: NF9321_high_15
Description: NF9321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9321_high_15
NF9321_high_15
[»] chr1 (2 HSPs)
chr1 (1-259)||(36396285-36396543)
chr1 (83-148)||(2944053-2944118)


Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 36396543 - 36396285
Alignment:
1 cattggttgcagatacagtgcctacagccttaatggaaagtggattactaggttggctggtgacagatgaagtgtcaacgggcttgatgggaagttcatt 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36396543 cattggttgcagatacagtgcctacagccttaatggaaggtggattactaggttggctggtgacagatgaagtgtcaacgggcttgatgggaagttcatt 36396444  T
101 aacggttttgctcgcagctgtttcagtgtctgcagccataatggaaagttgattacttggttgactggtggtggctgaattgttgacgggcttgatggga 200  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36396443 aacagttttgctcgcagctgtttcagtgtctgcagccataatggaaagttgattacttggttgactggtggtggctgaattgttgacgggcttgatggga 36396344  T
201 agctcaataacagctttgcttgtagctgatgtagtgtccacagtcataggaagttgatg 259  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
36396343 agctcaataacagctttgcttgtagctgatgcagtgtccacagtcataggaagttgatg 36396285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 83 - 148
Target Start/End: Original strand, 2944053 - 2944118
Alignment:
83 cttgatgggaagttcattaacggttttgctcgcagctgtttcagtgtctgcagccataatggaaag 148  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
2944053 cttgatgggaagttcattaacagttttgctcgcagctgtttcagtgtcttcagccataatggaaag 2944118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University