View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9321_high_16 (Length: 254)
Name: NF9321_high_16
Description: NF9321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9321_high_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 8 - 254
Target Start/End: Original strand, 6503384 - 6503630
Alignment:
| Q |
8 |
ggtagattattctcaacgaaaaaatcattatcttccaatttctcgatcgctttcggttgatttgttcgcttgaaatttcctcgaacacctttagtcctca |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6503384 |
ggtagataattctcaacgaaaaaatcattatcttccaatttctcgatcgctttcggttgatttgttcgcttgaaatttcctcgaacacctttagtcctca |
6503483 |
T |
 |
| Q |
108 |
tcaccggcagttgtggatttagctcctgttccggcactggcgaagaaaattctgcagaagtaaccgctgccgtgtttacttcagattcactcctaatttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6503484 |
tcaccggcagttgtggatttagctcctgttccggcactggcgaagaaaattctgcagaagtaactgctgccgtgtttacttcagattcactcctaatttt |
6503583 |
T |
 |
| Q |
208 |
cttcttcctcacagccggttgccgatgcggatttagctccggttccg |
254 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6503584 |
cttcttcctcgcagccggttgccgatgcggattaagctccggttccg |
6503630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University