View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9321_low_30 (Length: 312)
Name: NF9321_low_30
Description: NF9321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9321_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 24933810 - 24933541
Alignment:
| Q |
1 |
tatacatgttgttattgtgatgtattgaaaggaatgtcatggtccattttatatgccatattgtatacaaatgctgtttttatcatattctaacaatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24933810 |
tatacatgttgttattgtgatgtattgaaaggaatgtcatggtccattttatatgccatattgtatacaa-tgctgtttttatcatattctaacaatatg |
24933712 |
T |
|
| Q |
101 |
atcgactttgttattatttttattgtacgagttggagacctctcccatccaactttcttgttcttgctatattgacaaagctcatttcacnnnnnnntgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24933711 |
atcgactttgttattatttttattgtacgagttggagacctctcccatccaactttcttgttcttgctatattgacaaagctcatttcacaaaaaaatgg |
24933612 |
T |
|
| Q |
201 |
aaatgctgtttattcttttttgtattaggatctaaaaatatgaaactattgcactattgaccttgtgtgca |
271 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
24933611 |
aaatgctgtatattcttttttgtataaggatctaaaaatatggacctattgcactattgaccttgtgtgca |
24933541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University