View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9321_low_39 (Length: 284)
Name: NF9321_low_39
Description: NF9321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9321_low_39 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 284
Target Start/End: Complemental strand, 9781316 - 9781051
Alignment:
| Q |
19 |
ctgaatataccaattcatatcttatcttattttcgtcttttcnnnnnnnagttagtaatttgagaatgttgaaaatcacaattttattatcttatcttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| | ||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9781316 |
ctgaatataccaattcatatcttatcttattt-cgtcttttctttttttatttagtaacttgagaatgttgaaaatcacaattttcttatcttatcttct |
9781218 |
T |
 |
| Q |
119 |
atatataaaccaacaaactcactttaa-gctgagcaaataaattaagaaagaaaaatatttcaaacaaagacatattttaatttctactttgatttttcc |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| |||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9781217 |
atattgaaaccaacaaactcactttaaagctcagcaaacaaattaacaaagaaaaatattccaaacaaagacatattttaatttctactttgatttttcc |
9781118 |
T |
 |
| Q |
218 |
tttatagaaaacaataggcaggaatgaaggttgcatgtctcgttttggtgttgtgcattgttgttgc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9781117 |
tttatagaaaacaataggcaggaatgaaggttgcatgtctcgttttggtgttgtgcattgttgttgc |
9781051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University