View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9321_low_44 (Length: 273)
Name: NF9321_low_44
Description: NF9321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9321_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 36396543 - 36396285
Alignment:
| Q |
1 |
cattggttgcagatacagtgcctacagccttaatggaaagtggattactaggttggctggtgacagatgaagtgtcaacgggcttgatgggaagttcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36396543 |
cattggttgcagatacagtgcctacagccttaatggaaggtggattactaggttggctggtgacagatgaagtgtcaacgggcttgatgggaagttcatt |
36396444 |
T |
|
| Q |
101 |
aacggttttgctcgcagctgtttcagtgtctgcagccataatggaaagttgattacttggttgactggtggtggctgaattgttgacgggcttgatggga |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36396443 |
aacagttttgctcgcagctgtttcagtgtctgcagccataatggaaagttgattacttggttgactggtggtggctgaattgttgacgggcttgatggga |
36396344 |
T |
|
| Q |
201 |
agctcaataacagctttgcttgtagctgatgtagtgtccacagtcataggaagttgatg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36396343 |
agctcaataacagctttgcttgtagctgatgcagtgtccacagtcataggaagttgatg |
36396285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 83 - 148
Target Start/End: Original strand, 2944053 - 2944118
Alignment:
| Q |
83 |
cttgatgggaagttcattaacggttttgctcgcagctgtttcagtgtctgcagccataatggaaag |
148 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2944053 |
cttgatgggaagttcattaacagttttgctcgcagctgtttcagtgtcttcagccataatggaaag |
2944118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University