View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9321_low_51 (Length: 247)
Name: NF9321_low_51
Description: NF9321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9321_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 136 - 235
Target Start/End: Original strand, 25268587 - 25268688
Alignment:
| Q |
136 |
aaggctttgcaatccttcttcgttaactccttatgcgcagctc--tttctgtttcagttgcattcccttcaaagtcttcataacccttccgcatgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||| ||| || |
|
|
| T |
25268587 |
aaggctttgcaatccttcttcgttaactccttatgcgcagctctttttgtgtttcagttgcattcccttccaagtcttcataacccttccgcacgatatc |
25268686 |
T |
 |
| Q |
234 |
ca |
235 |
Q |
| |
|
|| |
|
|
| T |
25268687 |
ca |
25268688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 77 - 199
Target Start/End: Complemental strand, 30048030 - 30047908
Alignment:
| Q |
77 |
ttgtagccttagaaattttctcaaaatttccttcattaaccccttgttgaatgaagatcaaggctttgcaatccttcttcgttaactccttatgcgcagc |
176 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| ||| ||| |||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
30048030 |
ttgtagccgtagaaattttatcaaaatttcctccatcaacaccttgttgaatgaagaacactgctttgcaatccttcttctttaactccttatgtgcaat |
30047931 |
T |
 |
| Q |
177 |
tctttctgtttcagttgcattcc |
199 |
Q |
| |
|
||||| | |||||||||||||| |
|
|
| T |
30047930 |
tctttgtacttcagttgcattcc |
30047908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 175
Target Start/End: Original strand, 16598338 - 16598374
Alignment:
| Q |
139 |
gctttgcaatccttcttcgttaactccttatgcgcag |
175 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16598338 |
gctttgcaatccttcttctttaactccttatgcgcag |
16598374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University