View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9321_low_52 (Length: 247)

Name: NF9321_low_52
Description: NF9321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9321_low_52
NF9321_low_52
[»] chr2 (1 HSPs)
chr2 (136-235)||(25268587-25268688)
[»] chr5 (2 HSPs)
chr5 (77-199)||(30047908-30048030)
chr5 (139-175)||(16598338-16598374)


Alignment Details
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 136 - 235
Target Start/End: Original strand, 25268587 - 25268688
Alignment:
136 aaggctttgcaatccttcttcgttaactccttatgcgcagctc--tttctgtttcagttgcattcccttcaaagtcttcataacccttccgcatgatgtc 233  Q
    |||||||||||||||||||||||||||||||||||||||||||  ||| ||||||||||||||||||||| |||||||||||||||||||||| ||| ||    
25268587 aaggctttgcaatccttcttcgttaactccttatgcgcagctctttttgtgtttcagttgcattcccttccaagtcttcataacccttccgcacgatatc 25268686  T
234 ca 235  Q
    ||    
25268687 ca 25268688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 77 - 199
Target Start/End: Complemental strand, 30048030 - 30047908
Alignment:
77 ttgtagccttagaaattttctcaaaatttccttcattaaccccttgttgaatgaagatcaaggctttgcaatccttcttcgttaactccttatgcgcagc 176  Q
    |||||||| |||||||||| |||||||||||| ||| ||| |||||||||||||||| ||  |||||||||||||||||| ||||||||||||| |||      
30048030 ttgtagccgtagaaattttatcaaaatttcctccatcaacaccttgttgaatgaagaacactgctttgcaatccttcttctttaactccttatgtgcaat 30047931  T
177 tctttctgtttcagttgcattcc 199  Q
    ||||| |  ||||||||||||||    
30047930 tctttgtacttcagttgcattcc 30047908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 175
Target Start/End: Original strand, 16598338 - 16598374
Alignment:
139 gctttgcaatccttcttcgttaactccttatgcgcag 175  Q
    |||||||||||||||||| ||||||||||||||||||    
16598338 gctttgcaatccttcttctttaactccttatgcgcag 16598374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University