View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9321_low_59 (Length: 239)
Name: NF9321_low_59
Description: NF9321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9321_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 46926211 - 46926422
Alignment:
| Q |
14 |
ctgaacaaagtagataatatcattgtaaagcttcttcatgtgagctaactcagacattaacatgttgttacttcttcttagtctttcattatcttcagaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46926211 |
ctgaacaaagtagataatatcattgtaaagcttcttcatgtgagctaactcagacattaacatgttgttacttcttcttagtctttcattgtcttcagaa |
46926310 |
T |
 |
| Q |
114 |
agagcagtaacagaagtattgtagttgtttgttgctgttgtttgtgttcctccattaacaaatgatggtgaagttaatggtggagagtcgcaccagttgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46926311 |
agagcagtaacagaagtattgtagttgtttgttgctgttgtttgtgttcctccattaacaaatgatggtgaagttaatggtggagagtcgcaccagttgt |
46926410 |
T |
 |
| Q |
214 |
tgagttgttcat |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46926411 |
tgagttgttcat |
46926422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University