View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9321_low_63 (Length: 229)
Name: NF9321_low_63
Description: NF9321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9321_low_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 3854525 - 3854310
Alignment:
| Q |
11 |
ttattagttttagcatgctcagagtttctgttgctgaatgattctagcatgctactagnnnnnnnnnngattactacacctttttatcttaatcttaact |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3854525 |
ttattggttttagcatgctcagagtttctgttgctgaatggttctagcatgctactagaaaaaaaa--gattactacacctttttatcttaatcttaact |
3854428 |
T |
|
| Q |
111 |
atagttattttctttgcaaagagttgcatgttgcgcattgctctttccatgttcccgatcacgcttttctaacttattcttttgcttaaataaaacaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854427 |
atagttattttctttgcaaagagttgcatgttgcacattgctctttccatgttcgcgatcacgcttttctaacttattcttttgcttaaataaaacaaaa |
3854328 |
T |
|
| Q |
211 |
ctctctctcaccatttat |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3854327 |
ctctctctcaccatttat |
3854310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 80 - 121
Target Start/End: Complemental strand, 3854571 - 3854530
Alignment:
| Q |
80 |
attactacacctttttatcttaatcttaactatagttatttt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854571 |
attactacacctttttatcttaatcttaactatagttatttt |
3854530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 39 - 116
Target Start/End: Original strand, 4142099 - 4142172
Alignment:
| Q |
39 |
tgttgctgaatgattctagcatgctactagnnnnnnnnnngattactacacctttttatcttaatcttaactatagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142099 |
tgttgctgaatgattctagcatgctactcgaaaaaa----gattactacacctttttatcttaatcttaactatagtt |
4142172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University