View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9322_low_6 (Length: 330)
Name: NF9322_low_6
Description: NF9322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9322_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 18 - 324
Target Start/End: Complemental strand, 3440273 - 3439967
Alignment:
| Q |
18 |
aacaagtacatgttcttcagtcctcaggattacaacagcggagtactttctccttttcagacagcaaattttccgcttttctctttctgagctcaccaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3440273 |
aacaagtacatgttcttcagtcctcaggattacaacagcggcgtactttctccttttcagacagcaaattttccgcttttctctttctgagctcaccaac |
3440174 |
T |
 |
| Q |
118 |
tattttattaacatatgcaatgtatctgtcaacatcaaattttcttttgcacccttcgtaattcatgtatcgaattttcccaaaaatgggacgctctcgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3440173 |
tattttattaacatatgcaatgtatctgtcaacatcaaattttcttttgcacccttcgtaattcatgtatcgaattttcccaaaaatgggacgctctcgc |
3440074 |
T |
 |
| Q |
218 |
cacccctgaaatgaatagaagcacaaataccaaaaactgagaaatcttgaagaaaatttacacttctagttctacatgatttttatacaatcccctgcaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3440073 |
cacccctgaaatgaatagaagcacaaataccaaaaactgagaaatcttgaagaaaatttacacttctagctctacatgatttttatacaatcccctgcaa |
3439974 |
T |
 |
| Q |
318 |
caccaaa |
324 |
Q |
| |
|
||||||| |
|
|
| T |
3439973 |
caccaaa |
3439967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University