View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9323_low_13 (Length: 252)
Name: NF9323_low_13
Description: NF9323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9323_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 41346655 - 41346426
Alignment:
| Q |
1 |
cggtctcgtgttgatggacgatgttataggtgtcgcttgtctacgaaacatatagttttctttcttgtccccttgtttgtgttttattttccatttcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41346655 |
cggtctcgtgttgatggacgatgttataggtgttgcttgtctacgaaacatatagttttctttcttgtccccttgtttgtgttttattttccattttatg |
41346556 |
T |
 |
| Q |
101 |
aagnnnnnnnnnn-gtacaagaacgaaaaatagtgatagaaaaacatttgtaggaccattattcaaagaaaaaatttagaggtactaaacacaaaattta |
199 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41346555 |
aagaagaaaaaaaagtacaagaacgaaaaatagtgatagaaaaacatctgcaggaccattattcaaagaaaaaatttagaggtactaaacacaaaattta |
41346456 |
T |
 |
| Q |
200 |
atatatttacggattaaaaacttatttatc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41346455 |
atatatttacggattaaaaacttatttatc |
41346426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University