View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9324_low_6 (Length: 207)
Name: NF9324_low_6
Description: NF9324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9324_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 161
Target Start/End: Original strand, 27997786 - 27997929
Alignment:
| Q |
18 |
tcttttgggcacaagggaggtcccagcatggaggcaataaagatatgatgacatgatggtgtttgtggaaaaattacttcgtacaattatcatgcatatg |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27997786 |
tcttttggacacaagggaggtcccagcatggaggcaataaagatatgatgacatgatggtgtttgtggaaaaattacttcgtacaattatcatgcatatg |
27997885 |
T |
|
| Q |
118 |
caaagtgtaaacatagacatgcattttattgaagttttatttga |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27997886 |
caaagtgtaaacatagacatgcattttattgaagttttatttga |
27997929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 160 - 195
Target Start/End: Original strand, 27997943 - 27997978
Alignment:
| Q |
160 |
gagatttccaaactgttggatgtatatatgtctctg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27997943 |
gagatttccaaactgttggatgtatatatgtgtctg |
27997978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University