View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9325_low_11 (Length: 297)
Name: NF9325_low_11
Description: NF9325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9325_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 15 - 283
Target Start/End: Complemental strand, 28274296 - 28274028
Alignment:
| Q |
15 |
gacatcagtttgtcctggaactttgttgtcatcatcatccaagacgattacttcatgcccatggtaagacgtcttctcatgaccatggttagaccacttc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274296 |
gacatcagtttgtcctggaactttgttgtcatcatcatccaagacgactacttcatgcccatggtaagacgtcttctcatgaccatggttagaccacttc |
28274197 |
T |
 |
| Q |
115 |
tcacgggcatgatttcttccaagaaggacctccactggtgggcagcgaatattttcaaatgaagacaggagagaaaagttttttgctttctcccgtatgt |
214 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274196 |
tcacaggcatgatttcttccaagaaggacctccactggtgggcagcgaatattttcaaatgaagacaggagagaaaagttttttgctttctcccgtatgt |
28274097 |
T |
 |
| Q |
215 |
gatcaaatactgttttctcagtaatgattttgaatttgtcttcttgaacctcggtagcacactcatctt |
283 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274096 |
gatcaaatactgttttctcagtgatgattttgaatttgtcttcttgaacctcggtagcacactcatctt |
28274028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University