View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9325_low_16 (Length: 274)
Name: NF9325_low_16
Description: NF9325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9325_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 79 - 259
Target Start/End: Original strand, 1879910 - 1880091
Alignment:
| Q |
79 |
atcttctggtttttggtgaaaagggc-atagtaatatgaaattcgattgaaaagctaataaagtttggtaaaaaattgttctactcggatatcgaacttg |
177 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||| |||||| | | |
|
|
| T |
1879910 |
atcttctggtttttggtgaaaagggttatagtaatatgaaattcgatcgaaaagttaataaagtttggtaaaaaattgttctattcgagaatcgaattcg |
1880009 |
T |
|
| Q |
178 |
gttttcctaaacaattcgtctgttaaccacttaagtcagagcacttagttcctcacttatcaattagaacatgttttcttat |
259 |
Q |
| |
|
||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1880010 |
gttctcctaaacaattcgtgtgttaaccacttaagtcagagcacttagttcctcccttatcaattagaacatgttttcttat |
1880091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University