View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9325_low_17 (Length: 274)
Name: NF9325_low_17
Description: NF9325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9325_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 257
Target Start/End: Complemental strand, 34432131 - 34431897
Alignment:
| Q |
11 |
aagcagagaatcacgtttctagaatcttccatcaccgccgtcgtcgccgccgtaatggtaacctgcttcttctcttccgatcatttctcaatgcgcgttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34432131 |
aagcagagaatcacgtttctagaatcttc------------cgtcgccgccgtaatggtaacctgcttcttctcttccgatcatttctcaatgcgcattt |
34432044 |
T |
 |
| Q |
111 |
cgattttcaactctatcgtttgaatcactaacttcaatttcttcacactttagttttcttcaatttcttcattttcaaccgattaaatcgctttaactat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34432043 |
cgattttcaactctatcgtttgaatcactaacttcaatttcttcacactttagttttcttcaatttcttcattttcaaccgattaaatcgctttaactgt |
34431944 |
T |
 |
| Q |
211 |
gcattatttggattcacttcaaaagttaacctattcgcgttcagaat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431943 |
gcattatttggattcacttcaaaagttaacctattcgcgttcagaat |
34431897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University