View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9326_high_14 (Length: 238)
Name: NF9326_high_14
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9326_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 80 - 224
Target Start/End: Complemental strand, 36954504 - 36954360
Alignment:
| Q |
80 |
taaaagtagaccaaccatatggtaagtgtggaatggagtgactagaattggtcacatgatcatttccatgttttgtgactgacagtattgattcatatct |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
36954504 |
taaaagtagaccaaccatatggtaagtgtggaatggagtgactagaattggtcacatgatcatttccatgtattgcgactgacagtattgattcatatct |
36954405 |
T |
 |
| Q |
180 |
ttcctcttaagcnnnnnnncttgtgagctcaatagagtcattatt |
224 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36954404 |
ttcctcttaagcaaaaaaacttgtgagctcaatagagtcattatt |
36954360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University