View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9326_high_9 (Length: 253)
Name: NF9326_high_9
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9326_high_9 |
 |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0219 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 134 - 236
Target Start/End: Complemental strand, 10712 - 10610
Alignment:
| Q |
134 |
caagattagctaatgcacctacacacatattagcttcatgatatgagtgtcgcacccagtggcggatcttgagtggttttgttggtggtgccataaaact |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
10712 |
caagattagctaatgcacctacacacatattagcttcatgatatgagtgtcgcacccagtggcggatcttgggtggttttgttagtggtgccataaaact |
10613 |
T |
 |
| Q |
234 |
ata |
236 |
Q |
| |
|
||| |
|
|
| T |
10612 |
ata |
10610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University