View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9326_low_14 (Length: 308)
Name: NF9326_low_14
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9326_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 292
Target Start/End: Original strand, 37077840 - 37078113
Alignment:
| Q |
19 |
atcattcatttcaaaattgaatcttatttattatcattaggagaaaattactctcaattttggaagtagcaacttagacatgtaattatgggtgcgtgca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37077840 |
atcattcatttcaaaattgaatcttatttattatcattaggagaaaattactctcaattttggaagtagcaacttagacatgtaattatgggtgcgtgca |
37077939 |
T |
|
| Q |
119 |
ttttgaatcccaataaaccagttttaaccacacgatgaaattaccacgtttattttaaccgtggattgagttagtgacaaaacagacgcaaatggttaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37077940 |
ttttgaatcccaataaaccagttttaaccacacgatgaaattaccacgtttattttaaccgtggattgagttagtgacaaaacagacgcaaatggttaca |
37078039 |
T |
|
| Q |
219 |
cnnnnnnnnnnnnnnnnccctccatcttttattcagtctctctcctctaatgcaaatggttacatacttatatt |
292 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37078040 |
cttttttttccttttttccctccatcttttattcagtctctctcctctaatgcaaatggttacatacttatatt |
37078113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University