View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9326_low_2 (Length: 435)
Name: NF9326_low_2
Description: NF9326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9326_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 18 - 287
Target Start/End: Complemental strand, 33455353 - 33455090
Alignment:
| Q |
18 |
aaatgatgcaagaaaattaattagaaaacatatgaaaataaaaatacatgaaattttgctttcatcattttcaggtttgtgttatcatatgtcatgtann |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
33455353 |
aaatgatgcaagaaaatta----gaaaacatatgaaaataaaaatacatgaaattttgctttcatcattttcaggtttgagttatcat--gtcatgtaat |
33455260 |
T |
 |
| Q |
118 |
nnnnnnnnnnnnnnnnnnngacacacatgtaatattgtacctgatagatgtgaagagtatgaaaggatgaagagttttcaaacatcgttatcacttctga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33455259 |
atatatatatacatatatagacacacatgtaatattgtacctgatagatgtgaagagtatgaaaggatgaagagttttcaaacatcgttttcacttctga |
33455160 |
T |
 |
| Q |
218 |
gctattgaagggttcttgaattccttctctctcacacatacaggcacactcacatatgcactctcaatgg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33455159 |
gctattgaagggttcttgaattccttctctctcacacatacaggcacactcacatatgcactctcaatgg |
33455090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 336 - 435
Target Start/End: Complemental strand, 33455041 - 33454942
Alignment:
| Q |
336 |
gcagttagtactattgtctatgcaacacaacttatggaaaaagaaagcatacaattataaaaattaaaaatggtggatttggaggggactcatatatctc |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33455041 |
gcagttagtactattgtctatgcaacacaacttatggaaaaagaaagcatacaattataaaaattaaaaatggtggatttggaggggactcatatatctc |
33454942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University